Ilham A. Bunyan*, Qasim Ali Jassem Alkhuzaee
Dept. of Microbiology, College of Medicine, Babylon, Al – Qasim General Hospital, Babylon Health Directorate, Hilla, Iraq
*Corresponding Author E-mail: Ilhamalsaedi2008@gmail.com
ABSTRACT:
In this study, (100) clinical samples were collected from patients with urinary tract infection (UTI). Samples were then subjected for culturing on selective media to isolate Enterobacter cloacae. All clinical samples were positive culture, only (62) samples showed positive cultures, as gram negative bacteria whereas (38) bacterial growth were detected as gram positive bacteria. Among (62)gram negative bacteria, only 12(19.4%) isolates belonged to Enterobacter cloacae, isolates were identified by API20E. Sequencing of hsp60 gene and alignment of (341) base pare confirmed the identity of 8(12.9%) isolates. All DNA samples extracted from bacterial isolates were conducted for polymerase chain reaction to investigate presence of curli genes among isolates. The result revealed that 8(100%) of isolates were positive to Curli-specific Genes D(CsgD)gene, The Curli-specific Genes D (csgD)genes showed a bands of expected size (355) base pare in (8) isolates E. cloacae under study. Six of eight Enterobacter cloacae isolates produced (245) base pare amplification bands of Curli-specific Genes A (csgA)gene (75%). The results display significant positive correlation between biofilm formation and curlifambriae adhesion. Our results conclude the importance of curli fimbriae adhesion in establishment of biofilm and magnitude of biofilm formation in urinary tract infection (UTI)via antibiotics resistance and ascending infections.
KEYWORDS: Enterobacter cloacae, Curli fimbriae, Biofilm, PCR.
INTRODUCTION:
Enterobacter spp., belonging to the family Entero bacteriaceae utmost species are flagellated, and possess class 1 fimbriae. They ferment glucose with acid production, and they are negative for methyl red, positive for Voges-Proskauer, the optimal temperature for their growth 30°C, 80% are capsulated [1].
E. cloacae is a Gram-negative bacteria Facultatively-anaerobic, rod-shaped that is considered as Normal Micro flora in Gastrointestinal tract. Enterobacter have been implicated in a wide range of infections, particularly in impaired host defenses.
These infections include Bacteremia, Lower Respiratory Tract Infections, Skin and Soft-Tissue Infections, Urinary tract infections, Endocarditis, Intra-abdominal. Infections, Septic Arthritis, Osteomyelitis, CNS and Ophthalmic Infections. DNA genome of E..cloacae ,is (5.5).Mb and contain a single circular chromosome, with plasmids present depending on the strain [2].
The chromosome contains genes encoding adhesions, invasion proteins, ironchelating and hemolysin-like proteins. The size of E..cloacae ranges from (0.3-0.6 x 0.8-2.0) μm. E. cloacae, mesophilic bacteria with Optimal Temperature reach to (37°C) and motile with its peritrichous flagella, oxidase negative, catalase positive, They can produce ATP under aerobic conditions by aerobic respiration,. but when the oxygen absence they can convert to fermentation [3]. Curli is a new type of bacterial surface cell components which is expressed indifferent pathogenic bacteria includes E. cloacae, E coli and Salmonella .spp. and is specified by its capability to bind to fibronectin serum protein [4]. Curli fimbriae is concerned to surface bacterial adherence, cell accumulation and is a significant portion of the extracellular matrix essential to establishment of developed bacterial biofilms. Curli fimbriae is regarded as significant factor that Interact with host proteins, suggested to help microorganism spreading, in the host. These comprise proteins of extracellular matrix and contact-phase proteins. Curli is so regarded pathogen-associated molecular patterns (PAMPs.)[5].
An extremely control pathway including two forked expressed operons are essential for biosynthesis of curlifambriae. The major Curli subunit, csgA, and its homolog csg Bencodes by the csgBACoperon. The csg DEFGoperon encodes csgD. A transcriptional activator of the csgBACoperon, together with csgE and csgF, which act as chaperones and are needed for efficient Curli construction [6,7]. Curli homologous have formerly been recognized in several members of the Enterobacteriacae such as (Escherichia, shigella, Salmonella, Citrobacter and Enterobacter) [5]. Biofilm formation has a major effect on surface colonization of hospital equipment and indwelling medical devices such as urinary catheters, as part of the process of endourological development. Variety of foreign bodies has been feigned, with the increasing number of biomedical devices used in urinary catheters, biofilm formation considered the major steps for colonization and subsequent host infections. [8].
MATERIALS AND METHODS:
Samples:
During the study (100) urine samples were taken from patients with UTI who were admitted to Urology consultant clinic of Al-Hilla Surgical Teaching Hospital and AL-QasimGeneral Hospital in Babylon city (Iraq) during the period from October (2016) to February (2017). Confirmation of identity of the causative agents as E. cloacaewas performed with biochemical tests and API20E system.
Ethical approval:
The necessary ethical approval from ethical committee of the hospitals and patients and their followers must obtained. Moreover, all subjects involved in this work are informed and the agreement required for doing the experiments and publication of this work is obtained from each one prior the collection of samples.
Bacterial Growth and Biochemical Identification:
Identification of E. cloacae was done by the bacteriological methods including colonial morphology, Grams stain, and other biochemical tests. Characteristics of E. cloacae were subjected to biochemical tests for identification. The identification of Gram negative bacteria, was performed by various biochemical methods as follow oxidase test (to differentiate it from non Enterobacteriaceae bacteria), indole utilization test, Methyl red and Vogues – Proskauer test and Citrate utilization test (to differentiate it from E. coli and Citrobacter spp.), urease test, motility test, triple sugar iron test, Kligler iron agar test, Ornithine Decarboxylase test (to differentiate it from Klebsiella spp.) and Arginine Decarboxylase test (to distinguished between E. cloacae and E. aerogenes) according to [9]and [10].
DNA extraction form Enterobacter cloacae:
Genomic DNA was extracted from the Enterobacter cloacae isolates according to instruction provided by manufacturer using the geneaid DNA extraction Kit (GENEAID, USA) for purification of DNA. The purified DNA was checked by (0.7%) Agarose Gel Electrophoresis and viewed using UV-.transilluminator.
Molecular Confirmation of E. cloacae Isolates and Detection of Curli Biogenesis Genes:
The oligonucleotides primers Hsp60-F, (5’-GGTAGAAGAAGGCGTGGTTGC-3’) and Hsp60-R,(5’-ATGCATTCGGTGGTGATCATCAG-3’) were used to confirm the identification of E. cloacea [11]. The presence of a csgA and csgD Genes was determined by PCR using csgA and csgD-specific primers listed in Table (1). Chromosomal DNA was prepared for PCR analysis.
Table (1):The primers sequences used in this study
|
Gene's Name |
Primer sequence (5´- 3´) |
Product size |
Reference |
|
Hsp60 |
F GGTAGAAGAAGGCGTGGTTGC R ATGCATTCGGTGGTGATCATCAG |
341 |
[11]. |
|
csgA |
F ATTGCAGCAATCGTAGTTTCTGG R ATWGAYCTGTCATCAGAGCCCTGG |
245 |
[12] |
|
csgD |
F TGAAARYTGGCCGCATATCAATG R ACGCCTGAGGTTATCGTTTGCC |
355 |
[12] |
Table (2):Contents of the reaction mixture
|
NO. |
Contents of reaction mixture |
Volume |
|
1 |
Green master mix |
12.5µ |
|
2 |
Upstream primer |
2.5µ |
|
3 |
Downstream primer |
2.5µ |
|
4 |
DNA template |
5µ |
|
5 |
Nuclease free water |
2.5µ |
|
|
Total volum |
25µ |
Contents of the reaction mixture:
Amplification of DNA done in final volume of (25µ) containing the following as in Table (2)
PCR Thermocycling Conditions:
A single reaction mixture contained (2.5μl) of upstream primers, (2.5μl) of downstream primer, (5μl) of DNA extraction, (12.5μl) of master mix and (2.5μl) of nuclease free water; to obtain a total volume (25μl). Identification of amplified products was done by gel electrophoresis. The amplicons (5μl) was analyzed by Electrophoresis on (2%) Agarose Gel. They were visualized on a UV transilluminator (wave length) [12].Parameters conditions were installed as in Table (3).
Table (3):Thermocycling conditions
|
Cycle number |
Temperature (C)/ time Cycling condition |
Monoplex Gene |
||||
|
Final extension |
Extension |
Annealing |
Denaturation |
Initial denaturation |
||
|
35 |
72/5min |
72/15Sec |
60/15Sec |
95/15Sec |
95/5min |
Hsp60 |
|
35 |
72/5min |
72/15Sec |
60/15Sec |
95/15Sec |
95/5min |
csgA |
|
35 |
72/5min |
72/15Sec |
60/15Sec |
95/15Sec |
95/5min |
csgD |
Slime production test:
Slime products of all E. cloacae isolates were estimated by Congo Red Agar (CRA) method phenotypically as described by [13]. This medium comprise several components:,(37)g/l Brain Heart Infusion Broth, (50)g/L Sucrose, 10 g/L Agar and 0.8 g/L Congo Red. Samples of E. clocea were cultured on this media. All plates were incubated at 37°C for 24 hours and the growth were examined depend on color changes after (24) to (48) hours. Colonies with black discoloration, was considered as a positive test. When the bacterial colonies did not change the CRA media, the result considered as a non-slim producing bacteria.
Detection of Biofilm Formation:
Detection of Biofilm by Tissue culture plate (TCP) assay that described by [14] the results were explained according to the following, (<0.120) Non biofilm formation, (0.120-0.240) Moderate, (>0.240) High biofilm formation.
Measurement of Colanic acid Concentrations:
Colanic acid extraction and measurement of their concentration were performed according to [15] and modified by [16] method.
RESULTS:
Detection of Curli Fimbriae Genes by PCR:
The csgD genes showed bands of expected size (355bp.) in 8 isolates E. cloacae under study (100%). Six of eight E. cloacae isolates produced (245) bp amplification bands of csgA gene (75%). The results of PCR analyses for csgA and csgD Genes is shown in Figure (2), (3).
DISCUSSION:
Isolation and Identification:
In this study, (100) clinical samples were collected from patients with UTI. Samples were then subjected for culturing on selective media to isolate Enterobacter cloacae. All clinical samples were positive culture. This results was agreed with [17] who found that E. cloacea reaches to (13%) depending on identification with hsp60 gene. Another study revealed that E. cloacea consist (5.37%) isolated from different clinical samples [18]. On the other hand, in a [19] have pointed that the rate of E.cloacae isolation was 2.1 %. In another study, showed that a total number of 54 strains (6.3%) were isolated from different clinical specimens [20].
The isolation rate of E. cloacae varies from one study to another and this is affected by several factors such as extensive use and miss-use of the antibiotics, the different environmental conditions of Hospitals [21]. The pathogenesis of E. cloacae relies fundamentally on their capability to express and production of Curli fimbriae which is implicated in cells aggregation, adherence to surfaces, and Biofilm Formation. Two divergent operons controlled the Curli fambriae. The (csgBAC) Operon encodes the most important curli subunits, (CsgA), and its homolog (CsgB). While the (csgDEFG) Operon encodes (CsgD), with (CsgE) and (CsgF) that acts as chaperones needed for efficient Curli construction [22].:
Figure 1. Gel electrophoresis of PCR product of Hsp60 (341bp) Marker: L: lane 1, chromosomal DNA of isolates from 1-9 Lane 8 negative result
In our study, we confirmed the propagation of Curli Fimbriae Genes among Enterobacter cloacea Isolated from cases with (UTIs). this result demonstrated that Curli Fimbriae is an important and relevant virulence factors and that it can also contribute to virulence in Enterobacter cloacea isolates. All of E. cloacae urine isolates in this study possess csgD gene which shows the wide distribution of this adhesion among urine isolates. Six of isolates (75%) carried csgA gene and its absence in remaining (25%) of isolates may be probably due to the absence of entire csgA gene or point mutations within its coding sequence which correlates with the primer annealing site. Studies have shown that mutants of csgA show non-curliated phenotype [23].
Figure (2): Gel electrophoresis of PCR product of CsgD (355 bp Marker: L, lane 1, chromosomal DNA of isolates from (1-8)
Figure (3): Gel electrophoresis of PCR Product of CsgA Marker: L; lane 1, chromosomal DNA of isolates from (1-6)
Therefore, probably isolates of E. cloacae that produce the csgA are more virulent than those with no csgA synthesis and curli product. This may the reason for the extensive presence of csgA and csgD in E. cloacae strains isolated from urine from patients with UTI. Structural genes for curli fimbriae in important members of Enterobacteriaceae including E. cloacea are encoded by the (csgBAC), Operon. Biosynthesis of curliis commonly adjust by, either through (adrA) or directly by(csgD), a transcriptional activator, That forked transcribed to (csgBAC) [24]. The high prevalence of curli fimbriae genes were in accordance with previous results from studies conducted by other investigators as (22) who have found a high prevalence of curli fimbriae genes among E. cloacea strains. Some studies indicate that curli fimbriae are more important in the pathogenesis of E. cloacae [25].
The crystal violet (0.1%) staining was described in the literatures as a method that gave more positive, stable, and accurate results in terms of reproducibility, for both, gram-positive as well as gram-negative reference bacterial cells [26]. The Microliter plate test is a convenient and economical quantitative technique for the identification of critical factors and optimal culture conditions for biofilm formation. It has been used as a standard technique for rapidly accessing cell attachment and biofilm formation in a range of microorganisms [27] includes different bacteria as well as yeasts [28].
Figure (4) Ability of E. cloacea to the biofilm-producing phenotype by Congo red agar test (CRA)
Biofilm expedite the adherence of microorganisms to medical devices and protect them from host immune response and antimicrobial treatment. The production of biofilm may enhance the Colonization and leads to elevate rate of bacteriuria and such infections may be difficult to treat as they exhibit multi drug resistance [29]. Biofilms considered as a lifestyle which protect bacterial growth from harmful conditions. Bacterial biofilms are known to complicate management and the course of treatment for bacterial infections, including prostatitis, biliary tract infections, and urinary catheter cystitis and endocarditis, are now believed to be associated with biofilm formation [30].
Table (4): Relationship between biofilm formation and colanic acid concentration among Enterobacter cloacea
|
Isolate name |
Slim Layer (congo red) |
Biofilm formation TCP |
Colanic acid conc.(µg/ml) |
|
Ec1 |
Strong |
Strong |
48.3 |
|
Ec2 |
Strong |
Strong |
49.2 |
|
Ec3 |
Moderate |
Strong |
30.1 |
|
Ec4 |
Strong |
Strong |
35.8 |
|
Ec5 |
Moderate |
Strong |
43.1 |
|
Ec6 |
Strong |
Strong |
32.6 |
|
Ec7 |
Strong |
Moderate |
16.3 |
|
Ec8 |
Strong |
Moderate |
17.6 |
The ability of pathogenic bacteria to initiate biofilm on medical surfaces are difficult to manage and thus often involved in the development of different infections. Biofilm growth of pathogenic bacteria on tissues or medical devices often results in infections that have increased the antimicrobial resistance, tolerance to the Host Immune Response. The association between biofilm and antimicrobial resistance include different mechanisms and seems to be multifactorial. The understanding of bacterial biofim physiology indispensable to explain different infections and the other processes that are mediated by pathogenic bacteria [31]. Cystitis and asymptomatic bacteriuria seems to be a significant feature that associated with biofilm formation rather than pyelonephritis indicating the importance of this process in persistent and colonization of UTI. Recurrent Infections of all medical implants caused by colonization of several pathogenic bacteria present with their ability to form biofilm that serve as a major , role of these infections [32].
A total of (8) isolates of E. cloacea were detected to their ability of the biofilm-producing phenotype by Congo red agar test (CRA), all isolates (100%) were produce rough black colonies suggest that the isolates in this study have ability to produce biofilm. These results were shown in Figure (4). Biofilm formation in response to (1%) of glucose in Trypticase Soy Broth was studied on polymeric surfaces in the semi quantitative microtiter plate test.
This assay was repeated as triplicate to increase the accuracy of assy. According to mean of (OD). value at (630) nm the results were interpreted as (Non, Moderate and High) biofilm former when the mean of (OD) value were (<0.120 , 0.120-0.240, and >0.240) respectively. The results showed that 0/8(0%) of all isolates were non Biofilm Former. The isolates were described as Moderate were account for 2/8 (25%) while isolates that express strong biofilm formation were 6/8 (75%). Regarding to role of colonic acid concentrations in biofilm formation our results demonstrate the linear or positive relationship between colanic acid concentration and biofilm formation. Biofilm former colanic acid concentration ranged from (16.3- 49.2) μg /ml, these results were shown in Table. (4). Regarding to the relationship between biofilm formation and Curli Fambriae expression our results date that, there was strong positive correlation between biofilm former and csgA 6/8 (75%), csgD 8/8 (100%) Genes as shown in Table (5).
Table (5): Relationship between biofilm formation and presence of Curli Fimbrae Genes among Enterobacter cloacea isolates.
|
Total No. of isolates |
Biofilm former |
CsgA |
CsgD |
|
8 |
8 |
6 |
8 |
|
% |
100 |
75 |
100 |
Regarding to role of colonic acid concentrations in biofilm formation This results in agreement with [33] The three dimensional biofilm developments in medical devices is depends on presence of colonic acid, and this structure is not necessary for initial bacterial attachment, they concluded that the importance of colonic acid is started after the initial bacterial attachment phase. Colonic acid is a Negatively Charged Polymer of Glucose, Galactose, Fucose, and Glucuronic acid that form a protective capsule, surrounding the bacterial cell surfaces. Previous studies have shown that colonic acid synthesis is up-regulated in Biofilms, whereas it is well known that colanic acid is not synthesized in planktonic cells under normal laboratory growth conditions. Evidence suggests that capsular polysaccharides play a role in pathogenicity [34].
The expression of colanic acid has also been shown to be required for the creations of normal Escherichia coli biofilm structure However, these studies also indicate that colanic acid expression is not pertinent to the initial adhesion events. Colanic acid does not appear critical for bacterial adhesion and further biofilm development but contributes to the biofilm architecture and allows for the formation of massive biofilms.[35].
The exopolysaccharides (EPS) synthesized by pathogenic bacteria different in their composition and hence in their chemicals and physicals properties. They are neutral macromolecules, but the majority is poly anionic due to the presence of either uronic acids (d-glucuronics acid being the commonest, though d-dalacturonics and dmannuronics acids are also founds) or Ketal-linked .Pyruvate. The slow bacterial growth observed in most biofilms would also be expected to enhance EPS production as occurred in colonic-acid-producing E. coli. The limitations of antibiotics penetration during the biofilm formation is related to presence of Extrapolymeric substances. The mechanisms by which biofilms tighten the diffusion of antibiotics still obscure [36].
Regarding to the relationship between biofilm formation and Curli Fimbriae expression these results in accordance with [37] who display that biofilm Formation is a complicated process includes several sensory signals linked to itemized Genes regulation via a transcription factors array. Curli-specific Genes (csg),.are involved in construct biofilm in Enteric bacteria, they organized in the csgDEFG and csgBAC Bicistroanic Operon. csgEFG is required for export, and CsgD is a member of the LuxR family of transcriptionals regulators that activates csgBA to synthesizes the structural components of curli fimbriae. CsgD controlling the synthesis of the extracellular matrix components cellulose and Curli fimbriae in Bacterial cells responsible for biofilm formation. Curli fimbria, an Amyloid-like pertinacious substances, is another major components of the extracellular matrix in Biofilm and is encodes by the csgBAC-csgDEFG Operon..[38].
Previous studies explain to us that the CsgD is essential for formation of biofilm and the Individual bacterial cell may express CsgDin low levels than the multicellular bacterial cells. (30) identified the bistable characteristics of CsgD expression: a subpopulations of bacterial cells in biofilm has a high level of CsgD expression,. Whereas in another subpopulations of bacterial communities, the expression of CsgD is low. The bacteria with up regulated CsgD expression are responsible for generating the extracellular matrix and for forming the biofilm components that encases the low CsgD-expressing microorganisms. The Bi-stable CsgD expression saves energy in biofilm production, it may confer additional advantages to the entire bacterial community while protected the developmental potential of the population. Activation of the csgD promoter, can stimulate curli productions and Biofilm Formation in laboratory culture isolates [39].
CONCLUSIONS:
According to this study, we can conclude the only eight isolates of E. cloacae were isolated from urinary tract infections depending on (Hsp60)gene, predominate of biofilm formation among Enterobacter cloacae isolates recovered from UTIs and most isolates of Enterobacter cloacae were have curli fimbriae the important determinants to initiate the UTIs.
REFERANCES:
1. Hart, C. A., S. H. Gillespie and P. M. Hawkey Klebsiella, Citrobacter, Enterobacter and Serratia spp. In Principles and practice of clinical bacteriology, England, UK: John Wiley and Sons Ltd. 2ndEd. 2006; 377 – 386.
2. Chen, C. H,, Huang, C. C. Risk factor analysis for extended-spectrum beta-lactamase-producing Enterobacter cloacae bloodstream infections in central Taiwan. BMC Infect Dis. 2013; 13:417.
3. Hilty, M., Sendi, P., Seiffert, S.N., Droz, S., Perreten, V., Hujer, A. M. Characterization and clinical features of Enterobacter cloacae bloodstream infections occurring at a tertiary care university hospital in Switzerland: is cefepime adequate therapy? Int J Antimicrob Agents.2013; 41(3):236–49.
4. Bian, Z., Brauner, A., Li, Y., Normark, S. Expression of and cytokine activation by Escherichia coli curli fibers in human sepsis. J. Infect. Dis.2000; 181: 602–12.
5. Otzen, M., D, Nielsen, P. H. Curli functional amyloid systems are phylogenetically widespread and display large diversity in operon and protein structure. PLoS One. 2012; 7(12):e51274.
6. Taylor, J. D., Zhou, Y., Salgado, P.S., Patwardhan, A., McGuffie, M., Pape, T. Atomic resolution insights into curli fiber biogenesis. Structure.2011; 19(9):1307–16.
7. Otzen, D. E. Assembling good amyloid: some structures at last. Structure. 2011; 19(9):1207–9.
8. Tenke, P. The role of biofilm infection in urology. World J Urol. 2006; 24(1): 13–20.
9. McFadden, J.F. Biochemical tests for identification of medical bacteria. 3rded. The Williams and Wilkins. Baltimore, USA. 2000.
10. Forbes, B. A., Daniel, F. S., and Alice, S. W. Baily and Scott"s diagnostic microbiology. 12th ed., Mosby Elsevier company, USA. 2007.
11. Hoffmann, H., Stindl, S., Stumpf, A., Mehlen, A., Monget, D., Heesemann, J., Schleifer, K. H., Roggenkamp, A. Description of Enterobacterludwigii sp. nov.a novel Enterobacter species of clinical relevance. Sys. Appl. Microbiol. 2005; 28(3): 206-12.
12. Akbari, M., Bakhshi, B., Peerayeh S. N. and Behmanesh M. Detection of Curli Biogenesis Genes Among Enterobacter cloacae Isolated From Blood Cultures. Int. J. Enteric. Pathog. 2015; 3(4): e28413.
13. Freeman, D. J., Falkiner, F.R., Keane, C.T. New method for detectingslime production by coagulase negative staphylococci.J.Clin.Pathol.1989; 42:872-874.
14. Christensen, G. D. Simpson, W.A. Younger, J.A., Baddour, L.M. Barrett, F.F. and Melton, D.M. Adherence of cogulase negative Staphylococi to plastic tissue cultures:a quantitative model for the adherence of staphylococci to medical devices. J. Clin. Microbiol.1985; 22:996–1006.
15. Dische,Z. and Shettle, L.B. A new spectrophotometric test for the detection of methylpentose. J. Bio. Chem. 1995; 192: 579-582.
16. AL-Saedi, I.A. Isolation and identification of Klebsiella pneumonia from various infections and detection of some virulence factors associated in their pathogenicity in Hilla city.M.Sc. Thesis. College of Science, Babylon University, Iraq. 2000.
17. Grosshadern, K., Pettenkofer, M. V. Population Genetics of the Nomenspecies Enterobacter cloacae. Appl. And Enviro. Microbiol. 2003; 69(9): 5306–5318.
18. Abid, A. J. Alcharrakh, A. H, Husien, H. Phenotypic and molecular characterization of antibiotics resistance E. cloacae isolates. Int.J.Appl.Bio.Pharm.Tech.2015; 6(1):154-164.
19. Helander, A. and D. Helen. Urinary tract infection: A risk factor for false-negative urinary ethyl glucuronide but not ethyl sulfate in the detection of recent alcohol consumption. Clin. Chem. 2005; 51(9): 333-345.
20. Keller, R., Pedroso, M. Z., Ritchmann , R. and Silva, R. M. Occurrence of virulence – associated properties in Enterobacter cloacae. Infection and Immunity. American Society for microbiology. 1998; P: 645 – 649.
21. Kartali, G. Tzelepi, E. Pournaras, S. Kontopoulou, C. Kontos, F. Sofianou, D. A. N. Maniatis and A. Tsakris. Outbreak of Infections Caused by Enterobacter cloacae Producing the Integron-Associated ß-Lactamase IBC-1 in a Neonatal Intensive Care Unit of a Greek Hospital. Antimicrob. Agents and Chemother.2008; 46(5): 1577-1580.
22. Akbari, M., Bakhshi, B., Peerayeh, S. N., Behmanesh, M. The curli biogenesis genes expression level is unassociated with Enterobacter cloacae hsp60 clusters and PFGE genotypes. Microbial Pathogenesis 2016; 98: 112-117.
23. Barnhart, M. M., Chapman, M. R. Curli biogenesis and function. Annu Rev Microbiol.2006; 60:131–47.
24. Zogaj, X., Bokranz, W, Nimtz, M. and Ute Ro, M. Production of Cellulose and Curli Fimbriae by Members of the Family Enterobacteriaceae Isolated from the Human Gastrointestinal Tract. Infect. Immun. 2003; 71(7): 4151–4158.
25. Barnhart, M. M. and Chapman, M. R. Curli Biogenesis and Function. Annu. Rev. Microbiol. 2006; 60: 131–147.
26. Stepanovic, S., Ćirkovic, I., Ranin, L. and ŠvabiĆ-VlahoviĆ. M. Biofilm formation by Salmonella spp. and Listeria monocytogenes on plastic surface. Lett. Appl. Microbiol. 2004; 38:428-432.
27. Djordjevic, D., Wiedmann, M. and McLandsborough, L. A. Microtiter plate assay for assessment of Listeria monocytogenes biofilm formation. Appl. Environ. Microbiol. 2002; 68:2950-2958.
28. Matz,C., McDougald, D., Moreno, A.M., Yung, P.Y., Yildiz, F.H. and Kjelleberg, S. Biofilm formation and phenotypic variation enhance predation-driven persistence of Vibrio cholerae. Proc. Nat. Acad. Sci. USA. 2005; 102:16819-16824.
29. Murugan, S., Devi, P.U. and John, P. N. Antimicrobial susceptibility batterns of biofilm producing E. coli of urinary tract infections. Curr. Res. Bacteriol. 2011; 4(2):73-80.
30. Jackson, D. W., Suzuki, K, Oakford, L Simecka, J.W Hart, M. Eand Romeo, T. Biofilm Formation and Dispersal under the Influence of theGlobal Regulator CsrA of Escherichia coli. J. bacterial.2002; 184(1): 290–301.
31. Hancock, V., Ferrie`res, L. and Klemm, P. Biofilm formation by asymptomatic and virulent urinary tract infections Escherichia coli strains. FEMS Microbiol. Lett.2007; 267:30-37.
32. Danese, P. N., L. A. Pratt, and R. Kolter. Exopolysaccharide productionis required for development of Escherichia coli K-12 biofilm architecture. J. Bacteriol. 2000; 182:3593–3596.
33. Christensen, T. E., O. Saxtrup, T. I. Hansen, B. H. Kristensen, B. L. Beck, T. Plesner, I. M. Krogh, V. Andersen, and S. Strandgaard. Familialmyoglobinuria. A study of muscle and kidney pathophysiology in three brothers. Dan. Med. Bull. 2010; 30:112–115.
Mongkolrob, R., Taweechaisupapong, S. T aweechaisupapong, S. Correlation between biofilm production, antibiotic susceptibility and exopolysaccharide composition in BurkholderiapseudomalleibpsI, ppk, and rpoS mutant strains.Microbiology and Immunology.2015;
35. Bordeau, V. and Felden, B. Curli synthesis and biofilm formation in enteric bacteria are controlled by a dynamic small RNA module made up of a pseudo not assisted by an RNA chaperone. Nucleic Acids Research. 2014; 42(7):4682-4696.
36. Grantcharova, N., Peters, V., Monteiro, C., Zakikhany, K., Ro mling, U. Bistable expression of CsgD in biofilm development of Salmonella entericaserovarTyphimurium. J. Bacteriol. 2010; 192: 456–466.
37. Prigent-Combaret, C., Brombacher, E., Vidal, O., Lejeune, P., Ambert, A., Landini, P. and Dorel, C. A complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgB gene. J.Bacteriol.2009; 183: 7213–7223.
38. Brombacher, E., Dore, C. Alexander, J. B. Zehnder, and Landini, P. The curli biosynthesis regulator CsgD co-ordinates the expression of both positive and negative determinants for biofilm formation in Escherichia coli. Microbiology. 2003; 149: 2847–2857.
39. Vidal, O., Longin, R., Prigent-Combaret, C., Dorel, C., Hooreman, M. Lejeune, P. Isolation of an Escherichia coli K-12 mutant strain able to form biofilms on inert surfaces: involvement of a new omp R allele that increases curli expression. J. Bacteriol. 1998; 180: 2442–244.
Received on 09.10.2017 Modified on 16.10.2017
Accepted on 25.10.2017 © RJPT All right reserved
Research J. Pharm. and Tech 2017; 10(10):3294-3300.
DOI: 10.5958/0974-360X.2017.00584.4